DNA, the Black Plague and AIDS

Question

Just watched this really interesting YouTube video, "How One Village Miraculously Survived The Black Death"

After watching the video, I followed the directions on Kitty Cooper's blog to check my DNA for the Delta32:  https://blog.kittycooper.com/2019/01/are-you-genetically-resistant-to-aids/#comment-579904  Based on my 23andme autosomal DNA test, I have one Delta32.  I guess that means I will survive longer than normal if I get the Black Plague.  Woo-Hoo!!

Comments

Would living long WITH the black Plague be something you would want to do? lol

---

not sure about where the deletes are. just see a difference under the genotype. I have two of these.

GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA

Under Genes:  CCR5AS, CCR5

side affect: abdominal aortic aneurysm   My dad had this.

---

Under your genotype, It will show either -/ or -/- or neither of those.  That is how you can quickly tell your delta32 connection.

---

My point exactly, Mags.  Woo-Hoo!  Lucky me!

---

Here's another great (and historically informative) podcast about the Black Death and conditions across Europe at the time....   https://www.bloomberg.com/news/articles/2021-01-04/what-happened-to-europe-s-economy-after-the-black-death?sref=PKjmR2Nq

Answer 1

Interesting stuff. I've been meaning to do the DNA for some time now. Suppose I should quit procrastinating and 'get er done'! Curious to have that information to add to my profile.

Answer 2

That was fun. She says that the Delta32 is mostly found in northern Europeans and I descend mostly from southern Europeans. I don't have any of the Delta32, so I guess I will have to avoid AIDS "like the plague."

Answer 3

I watched this a few weeks ago and it was terribly interesting. The periodical Science News reported about 20 years ago that scientists studying Aids resistant prostitutes in Africa were scratching their heads...after watching this YouTube video I figured science solved that mystery.

Answer 4

I checked my results on 23andMe and I have one deletion -- meaning I have partial immunity to AIDS. As I understand it, having both deletions and thus having virtual immunity to AIDS is quite rare, like 1% of the population. I wish we were all lucky enough to have that mutation!

Answer 5

No deletes for me or my dad; one for my mom . . .

Answer 6

But this variant may make you more susceptible to COVID-19 severe outcome and death:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7347491/

You just can't win!

Interesting article about the double-edged sword of CCR5 variants vis-a-vis HIV and West Nile Virus:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3728730/