DNA Project Resources Page

Date: [unknown] [unknown]
Location: [unknown]

This Project Resources Page for the DNA Project

The DNA Project Resources Page

The DNA Project is a simple way to organize those of us who are interested in how WikiTree can integrate DNA test results on the limbs we share on WikiTree, as well as finding ways to expand the use of genealogical DNA on WikiTree. DNA Project Resources members take primary responsibility forgathering, organizing and posting DNA resources.

Contents 1 DNA Resources 1.1 General 2 DNA - from A to Z 2.1 Adenine 2.2 Allele 2.3 Allele Frequency 2.4 AMH 2.5 Atlantic Modal Haplotype (AMH) 2.6 auDNA Resources 2.7 Autosome 2.8 Base pair (BP) 2.9 Chromosome 2.10 Clade 2.11 Cladistics 2.12 Cladogram 2.13 Cline 2.14 Cytosine 2.15 Diploid 2.16 DNA (deoxyribonucleic acid) 2.17 DNA Fingerprinting 2.18 DNA Marker 2.19 DNA sequence 2.20 DNA Typing 2.21 Double Helix 2.22 DYS 2.23 EST 2.24 Flanking Region 2.25 Forensic 2.26 Gene 2.27 Gene expression 2.28 Gene mapping 2.29 Genetic Distance 2.30 Genetic markers 2.31 Genetic Profile 2.32 Genetics 2.33 Genome 2.34 Genome Project 2.35 Genotype 2.36 Guanine 2.37 Haplogroup 2.38 Haploid 2.39 Haplotype 2.40 Heredity 2.41 Homology 2.42 Homoplasy 2.43 Human Genome Initiative 2.44 Human Genome Organization (HUGO) 2.45 Human Genome Project (HGP) 2.46 Human Genome Program 2.47 Hypervariability 2.48 Informatics 2.49 In Vitro 2.50 Karyotype 2.51 Linkage Map 2.52 Localize 2.53 Locus (pl. loci) 2.54 Marker 2.55 Meiosis 2.56 Microsatellite 2.57 Minisatellites 2.58 Mitochondrial DNA (mt DNA) Resources 2.59 Monophyletic group (clade) 2.60 MRCA 2.61 Mutation 2.62 Nucleotide 2.63 Nucleus 2.64 Pedigree 2.65 Phenotype 2.66 Phylogeny 2.67 Polymerase Chain Reaction (PCR) 2.68 Polymorphism 2.69 Primer 2.70 Protein 2.71 Recombination 2.72 Sequence Tagged Site (STS) 2.73 Sequencing 2.74 Sex Chromosome 2.75 Short Tandem Repeats (STR) 2.76 More to Come - Page in Progress 2.77 X-DNA Resources 2.78 Y DNA Resources 3 DNA Resource Integration 3.1 Non-Vetted 3.2 Vetted 3.3 Integrators Search Parameters 4 Sources

DNA Resources

Remember a lot of questions can be answered by referring to the help pages link at the top right of pages.

• Styles and Standards Help with Styles and Standards]
• Formatting Help with formatting on a profile

• DNA Scholarships

This is a work in process. Intent is to provide a list of sources you might want to review that will help you understand DNA and using it for genealogy

General

Link	Author	Type (Book, Article etc)	Notes
Information on using GEDmatch utilities	by Barton Lewis and Kitty Cooper		Compare and analyze your DNA results.
WikiTree and DNA	Peter Roberts helped Roberta Estes	WikiTree DNA	Peter Roberts helped Roberta Estes put together this excellent introduction to WikiTree for genetic genealogy on her DNAeXplained blog. This is a good blog to share with friends who have taken a DNA test but haven't tried WikiTree yet.
DNA 101	Roberta Estes		Beginning DNA
International Society of Genetic Genealogy			This independent, noncommercial organization offers a DNA Newbies mailing list, comparisons of DNA tests in the marketplace, educational resources, and a wiki that is a valuable source of information.
DNA and Adoption	Mags Gaulden	WikiTree DNA	How to use WikiTree and DNA to help in the search for Birth family.
Cyndi's List - DNA, Genetics & Family Health			Links to useful sites, mailing lists, etc., with a focus on DNA testing in genealogy.
Genealogical DNA Test	Wikipedia	web site article	Covers procedure, types of tests, reviews of each test and what to expect, haplogroups and geographic origin tests, benefits and drawbacks, medical, DNA and genealogy software, references, further reading, and external links
Genetic Genealogy In Practice	Blaine T Bettinger; Debbie Parker Wayne	Book (English) website is for WorldCat library locations	Genetic Genealogy in Practice covers the basic knowledge needed to apply DNA evidence to genealogical questions and then reinforces this foundation with practical applications. Each chapter ends with exercises that include real problems that researchers encounter. Answers allow complex concepts to be reviewed and mastered. As well as covering the basics of DNA testing for family history research problems, Genetic Genealogy in Practice includes discussions of ethical issues, genealogical standards, and tips on how to incorporate genetic evidence into a written conclusion. Researchers of all levels will gain a better understanding of genetic genealogy from this book
How to Interpret Family History and Ancestry DNA Test Results for Beginners	Anne Hart	Google Book	How to read your results, overview of DNA testing companies, medical information from your test
Trace your roots with DNA	Megan Smolenyak; Ann Turner	Book (English) website is for WorldCat library locations	After a brief introduction to genealogy and genetics fundamentals, the authors explain the types of available testing, what kind of information the tests can provide, how to interpret the results, and how the tests work
DNA and Family History: How Genetic Testing Can Advance Your Genealogical Research	Chris Pomery	Google Book	Chris Pomery explains the practicalities of testing and interpreting the results. He also takes an objective look at the issues. Whether you are simply seeking to stay informed, actively interested in exploiting the technology, or already part of a DNA project, this is a guide that explores the existing possibilities.
Hiring a DNA Testing Company	Family Search Organization	web site article	Overview of testing and types, links to existing DNA projects, list of other websites, references
How to Use DNA Testing for Genealogy Research	JONATHAN STRICKLAND	How Stuff Works web article	Overview of testing and types, sets realistic expectations, gives positives and negatives of testing
Understanding genetic ancestry testing	This article was written by David Balding, Debbie Kennett and Mark Thomas. It was first published on the website of University College London's Molecular and Cultural Evolution Lab, and is reproduced here with their permission	From ISOGG Wiki	Concise overview of types of tests
Sorting out the DNA Tests Available for Genealogy	Thought Co. By Kimberly Powell	Web Article	Good overview of test types and when to use them.
The Bogus-ness of DNA Testing for Genealogy Research	REBECCA SKLOOT	Blog Article	Negative view of DNA testing for genealogical research.
Ethnicity Results – True or Not?	DNAeXplained-Genetic Genealogist	Web Article	Pros and Cons, how it works and interpreting results for Origin Displays
DNA Glossary	Genealogist for Lindsay surname	Web Article	Glossary of Terms

DNA - from A to Z

Adenine

One of the four bases in DNA that make up the letters ATGC, adenine is the "A".  The others are “G” for guanine, “C” for cytosine, and “T” for thymine.  Adenine always pairs with thymine.  Cytosine always pairs with guanine.  These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC.  These sequences are the code for genetic information. 

Allele

Alternative form of a genetic locus; a single allele for each locus is inherited separately from each parent (e.g., at a locus for eye color the allele might result in blue or brown eyes).

Allele Frequency

The proportion of a particular allele among the chromosomes carried by individuals in a population.

AMH

See Atlantic Modal Haplotype

Atlantic Modal Haplotype (AMH)

The descriptive term used by James F. Wilson to characterize the most common haplotype in parts of Europe. The markers and most common repeat values for the AMH are;

DYS19   = 14
DYS388 = 12
DYS390 = 24
DYS391 = 11
DYS392 = 13
DYS393 = 13

auDNA Resources

Link	Author	Type (Book, Article etc)	Notes
Blog about ADSA	Roberta Estes		Information on using the Autosomal DNA Segment Analyzer (ADSA) tool. www.DNAgedcom.com to help persons with results from Family Tree DNA's Family Finder to identify shared ancestry: and instructions on how to use ADSA.
Autosomal DNA	International Society of Genetic Genealogy Wiki	Web article	Intro, overview, accuracy, references and further reading sections
Lesson 5: Introduction to atDNA	Wheaton Surname Resources	Web article	Part of Beginners Guide to Genetic Genealogy
DNA Newsletters	Lost Cousins	Web article	Collection of various DNA related web articles with a bent to autosomal testing
Autosome	Wikipedia	Web article	Specific info on a type of chromosome used for autosomal DNA testing.
Autosomal DNA: Hints from our Ancestors	CeCe Moore	Web article	Good charts that help understand written explanations of how this works.
Chart of 4 Types of DNA	Google web image	Image of chart	Chart showing autosomal inheritance plus y, m and x
% Shared Autosomal DNA Inherited by relatives to the fifth cousin level	Fiona Milford	Image of chart	chart showing % of autosomal DNA by generation
Autosomal DNA testing comparison chart	International Society of Genetic Genealogy Wiki	Web article	compares autosomal tests from companies offering them
Distribution of genealogical relationships for given amounts of shared DNA	Blaine Bettinger, International Society of Genetic Genealogy Wiki	Web article	Chart shows distribution of genealogical relationships for given amounts of shared DNA
A Triangulation Intervention	Blaine Bettinger	Blog Post	Triangulation
auDNA Triangulation, Pt. 1	Debbie Kennett	Blog Post	Triangulation
auDNA Triangulation, Pt. 2	Debbie Kennett	Blog Post	Triangulation
Age of Segment	Steve Mount	Blog Post	Triangulation
Known Pile-up regions	ISOGG	Site Post	Triangulation
ADNA Utility	Wesley Erickson	Site	Triangulation Utility
Our Vast Shared Family Tree	Graham Coop	Site Post	"The problem is that we are related to all those distant cousins in multiple different ways. All our pedigrees start to collapse sooner or later. This means it becomes impossible to determine on which ancestral line the DNA is shared." Debbie Kennett

Autosome

A chromosome not involved in sex determination.  The diploid human genome consists of 46 chromosomes, 22 pairs of autosomes, and 1 pair of  sex chromosomes (the X and Y chromosomes). 

Base pair (BP)

Two nitrogenous bases (adenine and thymine or guanine and cytosine) held together by weak bonds.  Two strands of DNA are held together in the shape of a double helix by the bonds between base pairs.  A set of two bonded nucleotides on opposite strands of DNA.  There are two possible base pairs: C-G and A-T.  These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC.  These sequences are the code for genetic information.  Strung together in chains each base reaches  across and forms a pair with its complementary base on the opposite strand; like the rungs of a ladder.  Base pairing ensures that the genetic information, the sequence of bases in the DNA, is passed securely from generation to generation in a process called DNA replication.   

Chromosome

The self-replicating genetic structure of cells containing the cellular DNA that bears in its nucleotide sequence the linear array of genes.   In prokaryotes, chromosomal DNA is circular, and the entire genome is carried on one chromosome.  Eukaryotic genomes consist of a number of chromosomes whose DNA is associated with different kinds of proteins.  A rod-like structure of tightly coiled DNA found in the cell nucleus of plants and animals.  Chromosomes are normally found in pairs;human beings typically have 23 pairs of chromosomes.

Clade

From the Greek word klados, meaning branch.  A branch of biological taxa or species that share features inherited from a common ancestor. A single phyletic group or line. Also cladus.  Monophyletic group of taxa.

Cladistics

School of phylogenetic analysis emphasizing the branching patterns of monophyletic taxa relying on synapomorphies (vs. symplesiomorphies) to unite sister taxa. [See Avise, pp. 34-39, 121-122].

Cladogram

A diagram, in the form of a stylized tree, showing inferred historical branching patterns among taxa.

Cline

Continuous change in a trait or trait frequency over space or time.

Cytosine

One of the four bases in DNA that make up the letters ATGC, cytosine is the "C".  The others are “A” for adenine, “G” for guanine, and “T” for thymine.   Cytosine always pairs with guanine.  Adenine always pairs with thymine.  These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC.  These sequences are the code for genetic information. 

Diploid

A full set of genetic material, consisting of paired chromosomes one chromosome from each parental set.  Most animal cells except the gametes have a diploid set of chromosomes.  The diploid human genome has 46 chromosomes. 

DNA (deoxyribonucleic acid)

The molecule that encodes genetic information.  DNA is a double stranded molecule held together by weak bonds between base pairs of nucleotides.  The four nucleotides in DNA contain the bases: adenine (A), guanine (G), cytosine (C), and thymine (T).  In nature, base pairs form only between A and T and between G and C; thus the base sequence of each single strand can be deduced from that of its partner. 

DNA Fingerprinting

A term for DNA typing.  The chemical structure of everyone's DNA is the same.  The only difference between people (or any animal) is the order of the base pairs.  There are so many millions of base pairs in each person's DNA that every person has a different sequence.  Using these sequences, every person could be identified solely by the sequence of their base pairs.  However, because there are so many millions of base pairs, the task would be very time-consuming.  Instead, scientists are able to use a shorter method, because of repeating patterns in DNA.  These patterns do not, however, give an individual "fingerprint," but they are able to determine whether two DNA samples are from the same person, related people, or non-related people.  Scientists use a small number of sequences of DNA that are known to vary among individuals a great deal, and analyze those to get a certain probability of a match. 

DNA Marker

A gene or other fragment of DNA whose location in the genome is known. 

DNA sequence

The relative order of base pairs, whether in a fragment of DNA, a gene, a chromosome, or an entire genome. 

DNA Typing

The analysis of sections of DNA for purposes of identification. 

Double Helix

The shape that two linear strands of DNA assume when bonded together. 

DYS

D = DNA,  Y = Y chromosome, S = a unique DNA segment.  This nomenclature is controlled by the HUGO Gene Nomenclature Committee, with the assignment of new DYS numbers.  This guideline determines each part of the symbol for naming arbitrary DNA fragments and loci.  See section Appendix App 1.1 DNA Segments located at   http://www.gene.ucl.ac.uk/nomenclature/guidelines.html#1.4 

EST

Expressed Sequence Tag

Flanking Region

For microsatellites, the flanking regions are the stretches of DNA outside the simple sequence tandem repeat (STR). These sequences are used as primer pairs. The flanking regions are usually invariant across a population or species, but mutations in the flanking region can be a cause of null alleles as well as a potentially serious source of homoplasy (see Pemberton et al. 1995).

Forensic

Of or relating to courts or legal matters. Molecular markers are increasingly common in the context of forensics, both in wildlife and human cases involving identity or relatedness. 

Gene

The fundamental physical and functional unit of heredity.  A gene is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule). 

Gene expression

The process by which a gene's coded information is converted into the structures present and operating in the cell. Expressed genes include those that are transcribed into mRNA and then translated into protein and those that are transcribed into RNA but not translated into protein. 

Gene mapping

Determination of the relative positions of genes on a DNA molecule (chromosome or plasmid) and of the distance, in linkage units or physical units, between them.

Genetic Distance

Various statistics for measuring the 'genetic distance' between subgroups or populations. Major distance measures include Nei's distance (1972, 1978), Reynold's distance (Reynolds et al. 1983) and new distance measures that incorporate the stepwise mutation process in microsatellites (RST of Slatkin 1995a, b; D of Shriver et al., delta mu of Goldstein et al. 1995).  

Genetic markers

Alleles of genes, or DNA polymorphisms, used as experimental probes to keep track of an individual, a tissue, a cell, a nucleus, a chromosome, or a gene. Stated another way, any character that acts as a signpost or signal of the presence or location of a gene or heredity characteristic in an individual in a population.  There are 4 chromosome changes that do occur from generation to generation, and these are known as markers: 
a.      indels: these are insertions or deletions of the DNA at particular locations on the chromosome. An example is the YAP (Y chromosome alu polymorphism).
b.     SNPs: these are single nucleotide polymorphisms in which a particular nucleotide is changed (like A is changed to G).   Since SNPs(snips) and indels (stable alus) are very rare, they also are known as unique event polymorphisms (UEPs).
c.      microsatellites: these are short sequences of nucleotides (typically 2 to 5 core base pairs, example: ATCG) which are repeated multiple times in tandem.  Over time changes sometimes do occur, thus the number of repeats may increase or decrease.
d.     minisatellites: these are longer sequences of nucleotides (typically 9 to 80 core base pairs, example: TAAGGGCCA) which are repeated multiple times in tandem. Over time changes sometimes do occur and the number of repeats may increase or decrease. 

Genetic Profile

A collection of information about a person's genes. 

Genetics

The study of the patterns of inheritance of specific traits. 

Genome

All the genetic material in the chromosomes of a particular organism; its size is generally given as its total number of base pairs. 

Genome Project

Research and technology development effort aimed at mapping and sequencing some or all of the genome of human beings and other organisms. 

Genotype

The genetic makeup of an organism or set of DNA variants found at one or more loci in an individual, as characterized by its physical appearance or phenotype. Our external features - what scientists call our phenotypes - are different. We have a wide array of skin color, eye shape and color, hair texture. However our interior profile, or genotype - the organization of our genes on our chromosomes - identifies us all as Homo Sapiens.

Guanine

One of the four bases in DNA that make up the letters ATGC - guanine is the "G".  The others are “A” for adenine, “C” for cytosine, and “T” for thymine.  Guanine always pairs with cytosine. Adenine always pairs with thymine.   These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC. These sequences are the code for genetic information.

Haplogroup

a collection of closely related haplotypes. 

Haploid

A single set of chromosomes (half the full set of genetic material), present in the egg and sperm cells of animals and in the egg and pollen cells of plants. Human beings have 23 chromosomes in their reproductive cells.  Compare diploid.

Haplotype

A set of closely linked alleles (genes or DNA polymorphisms) inherited as a unit. A contraction of the phrase "haploid genotype".  Different combinations of polymorphisms are known as haplotypes.   Collectively the results from several loci could be referred to as a haplotype.  "Haplo" comes from the Greek word for "single".

Heredity

The handing down of certain traits from parents to their offspring. The process of heredity occurs through the genes.

Homology

Having the same origin (used for genes or characters deriving from a common ancestor).

Homoplasy

Similarity of traits or genes for reasons other than co-ancestry (e.g., convergent evolution, parallelism, evolutionary reversals, horizontal gene transfer, gene duplications). Homoplasy violates a basic assumption of the analysis of genetic markers -- variants of similar phenotype (e.g., base pair size) are assumed to derive from a common ancestor. [See Sanderson, M., and Hufford. 1996. Homoplasy: The Recurrence of Similarity in Evolution. Academic Press, NY ISBN 618030-X].

Human Genome Initiative

Collective name for several projects begun in 1986 by DOE to (1) create an ordered set of DNA segments from known chromosomal locations, (2) develop new computational methods for analyzing genetic map and DNA sequence data, and (3) develop new techniques and instruments for detecting and analyzing DNA. This DOE initiative is now known as the Human Genome Program. The national effort, led by DOE and NIH, is known as the Human Genome Project. 

Human Genome Organization (HUGO)

The Human Genome Organization (HUGO) is the international organization of scientists  involved in the Human Genome Project (HGP), the global initiative to map and sequence the human genome. HUGO was established in 1989 by a group of the world's leading genome scientists to promote international collaboration within the project. 
HUGO currently has over 1000 members representing over 50 countries. HUGO maintains three regional offices, HUGO Americas, HUGO Europe and HUGO Pacific, which carry out the administrative duties of the organization. 
Hugo carries out a complex coordinating role within the Human Genome Project.  HUGO activities range from support of data collation for constructing genetic and physical maps of the human genome to the organization of workshops to promote the consideration of a wide range of ethical, legal, social and intellectual property issues. 

Human Genome Project (HGP)

The national effort, initially led by DOE and NIH, is known as the Human Genome Project.  It is now an international initiative to map and sequence the human genome. 

Human Genome Program

This was previously known as the DOE’s Human Genome Initiative and is now known as the Human Genome Program.

Hypervariability

High degree of variation among individuals within local populations at a given genetic marker. Examples of hypervariable markers include minisatellites and microsatellites.  

Informatics

The study of the application of computer and statistical techniques to the management of information. In genome projects, informatics includes the development of methods to search databases quickly, to analyze DNA sequence information, and to predict protein sequence and structure from DNA sequence data. 

In Vitro

Outside a living organism. 

Karyotype

A picture of the chromosomes in a cell that is used to check for abnormalities.  A karyotype is created by staining the chromosomes with dye and photographing them through a microscope. The photograph is then cut up and rearranged so that the chromosomes are lined up into corresponding pairs. 

Linkage Map

A map of the relative positions of genetic loci on a chromosome, determined on the basis of how often the loci are inherited together. Distance is measured in centimorgans (cM). 

Localize

Determination of the original position (locus) of a gene or other marker on a chromosome. 

Locus (pl. loci)

The position on a chromosome of a gene or other chromosome marker; also, the DNA at that position. The use of locus is sometimes restricted to mean regions of DNA that are expressed. The specific physical location of a gene on a chromosome.  From the Latin for 'place'. A stretch of DNA at a particular place on a particular chromosome — often used for a 'gene' in the broad sense, meaning a stretch of DNA being analyzed for variability (e.g., a microsatellite locus).

Marker

An identifiable physical location on a chromosome (e.g., restriction enzyme cutting site, gene) whose inheritance can be monitored. Markers can be expressed regions of DNA (genes) or some segment of DNA with no known coding function but whose pattern of inheritance can be determined. A gene of known location on a chromosome and phenotype that is used as a point of reference in the mapping of other loci. 

Meiosis

The process of two consecutive cell divisions in the diploid progenitors of sex cells. Meiosis results in four rather than two daughter cells, each with a haploid set of chromosomes. 

Microsatellite

Repetitive stretches of short sequences of DNA used as genetic markers to track inheritance in families. They are short sequences of nucleotides (example: ATCG) which are repeated over and over again a number of times in tandem. Changes sometimes do occur, however, and the number of repeats may increase or decrease. See also Genetic Markers.

Minisatellites

Segments of repeated DNA often used as genetic markers for individual identification (forensic DNA 'fingerprinting') or analyses of relatedness. Can be either single- or multi-locus. Minisatellite technology relies on probe-based hybridization. Advantages include lack of need for specific primers and hypervariability.  Disadvantages include inability to use PCR amplification, the need for Southern blotting, and, for multi-locus minisatellites, the lack of locus-specificity (making population genetic analyses difficult). [See Avise, Fig. 3.16, p. 80].  

Mitochondrial DNA (mt DNA) Resources

Mitochondrial DNA which is passed down from the mother to all her children, males and females. The genetic material of the mitochondria, the organelles that generate energy for the cell. 

Link	Author	Type (Book, Article etc)	Notes
Information on using MitoSearch and mtDNA in WikiTree	Peter J. Roberts
New Native American Mitochondrial Haplogroups	Roberta Estes
Mitochondrial DNA	Wikipedia	Web Article	Overview
Mitochondrial DNA: The Eve Gene	Stephen Oppenheimer	Web Article	Overview
Fossil Hominids: mitochondrial DNA	Talk Origins Org	Web Article	Human and Neandertal MtDNA reviewed. Drawbacks to using MtDNA for human history based on new full sequence Neandertal MtDNA availability. Explanation of what an Eve is..
mtDNA Haplogroups	World Families . Net	Web Article	Chart and explanation of haplogroups
MtDNA testing comparison chart	International Society of Genetic Genealogy Wiki	Web Article	Compares tests offered by companies
MtDNA Haplogroup Descriptions & Information Links	Charles Kerhner	Web Article	Links and explanations of haplogroups and migrations
Mitochondrial DNA Analysis	University of Vermont	Class presentation	Dowloadable PDF. Indepth explanation of what it is, how it is used, why it is different from other DNA types, good chart
Maternal or Matrilineal Studies Using mtDNA	Philip Ritter Standford University	Web Page Overview	Concise overview
Mitochondrial DNA tests	International Society of Genetic Genealogy Wiki	Web Article	Charts and in depth review of MtDNA

Monophyletic group (clade)

Evolutionary assemblage of taxa that includes a common ancestor and all of its descendants. [See Avise, p. 36]. 

MRCA

Most recent common ancestor. 

Mutation

A permanent structural alteration in DNA. In most cases, DNA changes either have no effect or cause harm, but occasionally a mutation can improve an organism's chance of surviving and passing the beneficial change on to its descendants. 

Nucleotide

A sub-unit of DNA or RNA consisting of a nitrogenous base (adenine, guanine, thymine, or cytosine in DNA; adenine, guanine, uracil, or cytosine in RNA), a phosphate molecule, and a sugar molecule (deoxyribose in DNA and ribose in RNA). Thousands of nucleotides are linked to form a DNA or RNA molecule. 

Nucleus

The cellular organelle in eukaryotes that contains the genetic material. The center of a cell, where all of the DNA, packaged in chromosomes, is contained. 

Pedigree

A simplified diagram of a family's genealogy that shows family members' relationships to each other and how a particular trait or disease has been inherited. 

Phenotype

Our external features are called our phenotypes and are very different. We have a wide array of skin color, eye shape and color, hair texture. However our interior profile, or genotype - the organization of our genes on our chromosomes - identifies us all as Homo Sapiens.

Phylogeny

The evolutionary history of a species. 

Polymerase Chain Reaction (PCR)

An in vitro process that yields millions of copies of desired DNA through repeated cycling of a reaction involving the DNA polymerase enzyme.  Technique for amplifying nucleic acids in a thermal cycler. Involves use of forward and reverse primer pairs that start off the reaction. End yield is many orders of magnitude more DNA of the target sequence than one started with. The resulting amplified DNA can then be visualized with stains or radioactive labeling, or sized with fluorescent markers in a sequencer. [See Avise, p. 84, Fig. 3.18, p. 85].

Polymorphism

A term to show that mutations do occur in the Y chromosome, as can happen with other chromosomes. It is a naturally occurring or induced variation in the sequence of genetic information on a segment of DNA.

Primer

Short, preexisting single-stranded polynucleotide chain to which new deoxyribonucleotides can be added by DNA polymerase (to 'prime' PCR amplification). The primer anneals to a nucleic acid template (DNA of the organism of interest) and promotes copying of the template, starting from the primer site. To amplify microsatellites one uses a forward and reverse primer pair: [agctcagtccctagtcagtact]acacacacacacacacacacac[ggtacttcggagctatccgaattccct] In this example the bold, italicized bp are the forward and reverse primers (should not differ among individuals), whereas the un-italicized 'ac' repeat is the microsatellite. By running back and forth across the repeat one can amplify a few copies of the microsatellite region by orders of magnitude, yielding sufficient DNA to allow visualization of the amplified product on an acrylamide gel by staining with ethidium bromide. Some primer sequences may be conserved across wide taxonomic gaps (e.g., across families), while others may differ even among congeners.

Protein

A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene coding for the protein. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs, and each protein has unique functions. Examples are hormones, enzymes, and antibodies.

Recombination

Exchange of gene segments by crossing over at chiasmata (exchange of material between non-sister chromatids). The exchanged sections are usually homologous. The likelihood of recombination increases with increasing physical distance. 

Sequence Tagged Site (STS)

Short (200 to 500 base pairs) DNA sequence that has a single occurrence in the human genome and whose location and base sequence are known. Detectable by polymerase chain reaction, STS's are useful for localizing and orienting the mapping and sequence data reported from many different laboratories and serve as landmarks on the developing physical map of the human genome. Expressed sequence tags (EST's) are STS's derived from cDNA's. 

Sequencing

Determination of the order of nucleotides (base sequences) in a DNA or RNA molecule or the order of amino acids in a protein. 

Sex Chromosome

The X or Y chromosome in human beings that determines the sex of an individual. Females have two X chromosomes in diploid cells; males have an X and a Y chromosome. The sex chromosomes comprise the 23rd chromosome pair in a karyotype. Compare autosome. 

Short Tandem Repeats (STR)

Multiple copies of an identical DNA sequence arranged in direct succession in a particular region of a chromosome.

More to Come - Page in Progress

X-DNA Resources

Link	Author	Type (Book, Article etc)	Notes
Information on using X chromosome results in WikiTree	Peter J. Roberts
X-DNA and Genetic Genealogy.	Roberta Estes		Information on using X chromosome matching to help find shared ancestry:
X-chromosome testing	International Society of Genetic Genealogy Wiki	Web Article	Mainly links to other sites related to x-chromosome information
X-chromosome Ahnentafel Chart	Ann Turner	Web chart	Ahnentafel chart of X=chromosome related ancestresses
X Chromosome Inheritance	Jim Turner	Downloadable chart page	Downloadable charts
X-DNA Inheritance Charts	Deb Delving	Downloadable chart page	Downloadable charts see also x-DNA inheritance Charts
X-Chromosome Testing vs. mtDNA Testing	CeCe Moore Genetic Genealogist	Web Article	Compares two types and results you get from each. Good chart illustrations.
Simplified X-Chromosome Inheritance Female	Google Images	Chart	Chart
X Marks the Spot	DNAeXplained-Genetic Genealogy	Web Article	Lots of charts and explanations about how the X works, where it is found in your ancestral line, how to use it.
That Unruly X….Chromosome That Is	DNAeXplained-Genetic Genealogy	Web Article	Recombinant DNA and how it affects your X

Y DNA Resources

Link	Author	Type (Book, Article etc)	Notes
Information on using YSearch and Y-DNA in WikiTree	Peter J. Roberts	Blog
Y chromosome DNA tests	International Society of Genetic Genealogy Wiki	web article	Overview, haplogroups, other references, links, resources
Y chromosome	Wikipedia	web article	Overview with chart, haplogroups, genetic genealogy use, references, links
The Y-Chromosome and Genetic Genealogy	Philip Ritter Stanford University	web article	Concise Overview
Human Y-chromosome DNA haplogroup	Wikipedia	web article	In depth explanation of each haplogroup and how Y works with references and links
Y Haplogroups of the World chart	Google Images	chart	Haplogroup chart
Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage	Eupedia	Table by Country	Haplogroups by country
British and Irish surnames and Y-DNA	Ancestral Journeys	web article	Specific to British and Irish Surnames
Y-DNA haplogroup projects	International Society of Genetic Genealogy Wiki	web article
Distribution of Genealogical Relationships for given amounts of shared DNA	Blaine Bettinger, International Society of Genetic Genealogy Wiki	web article	Chart

DNA Resource Integration

Please list resources posted in G2G that might be good resources to incorporate into our DNA Resources Tables. Place G2G "grab and goes" (those resources that have not been researched for accuracy and authenticity), into the Non Vetted list.

Please list resources posted in G2G that have been researched for accuracy and authenticity, that are good resources to incorporate into our DNA Resources Tables, into the Vetted list. Once a resource has been vetted, it can be moved into the table for the resource.

Non-Vetted

Vetted

Integrators Search Parameters

G2G Search Parameter	Integrator	Integrator	Integrator
DNA
Genetic
Genetic Genealogy
Y-DNA
mt-DNA
MT-DNA
Y
mt
X-DNA
X
au-DNA	[https://cruwys.blogspot.ca/2016/01/autosomal-dna-triangulation-part-1.html auDNA Triangulation, Pt. 1, Debbie Kennett]	auDNA Triangulation, Pt. 2, Debbie Kennett	Age of Segment, Steve Mount
auDNA	Known Pile-up regions ISOGG
mtDNA
Y-DNA
autosomal DNA
Autosomal DNA
mitochondrial DNA
Mitochondrial DNA
Segment
Segments
DNA Segments
Chromosome
Choromosomes
Choromosomal
SNP
SNP's
Marker
Markers
Add more please…

Sources